Polytomella parva SAG 63-3

Downloads:

Reads

Annotations

Peptides

Contigs

CDS

Environmental Data
Principle Investigator(s)	David Smith
External sample ID	Polytomella parva SAG 63-3
NCGR Sample ID	MMETSP0052_2
Sample accession number	CAM_SMPL_002376
Assembly accession number	CAM_ASM_000194
Combined Assembly Name	N/A
Genus	Polytomella
Species	parva
Strain	SAG 63-3
Clonal	Yes
Axenic	Yes
Prelim. NCBI Taxon ID	51329
18S rRNA	TTTGGGGTTTACTTCAAGTCATCTGTCCTTTGGTGATTCATAATAACTTTACGAATCGCTGTTTTTTCAGCGATGTTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTGGTAACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCAACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCGTTTTACGTCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGATGATTTATCGCGGTCCTTATCTTTATGGTTTGCGTACTGCCTTGAATTATCTTTCTTTTGTTGGCGTTGAAGGGGTAGGACTCGTCTTGCTCCTTCAAATTCAACAAGTGGTTACTTTGAGTAAATTAGAGTGTTCAAAGCAAGCATATATCGCTCTGAATACGTTAGCATGGAATAACGCGATAGGACTCTGGCCTATTCGTTGGTCTGTGGGACTGGAGTAATGATTAAGAGGGACAGTCGGGGGCATTTGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACAAACATCTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATTAGATACCGTCGTAGTCTCAACCATAAACGATGCCGACTAGGGATTGGCAGATGGTTTTTTAATGCCTCTGCCAGCACCTTATGAGAAATCACAAGTCTTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGCGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAACTTACCAGGTCCAG
Importance of organism and transcriptomes	Polytomella parva is non-photosynthetic, naturally-wall-less unicellular green alga closely related to Chlamydomonas reinhardtii. A Polytomella transcriptome project will improve our understanding of photosynthesis and its associated reactions, further our knowledge of the evolutionary consequences of losing photosynthetic capabilities and increase the research potential of transcriptome sequences that are available from other chlorophyte algae.
Additional citations and references	Mallet, M. A. & Lee, R. W. 2006. Identification of three distinct Polytomella lineages based on mitochondrial DNA features. J. Eukaryot. Microbiol., 53:79-84; Smith, D. R., Hua, J. & Lee, R. W. 2010. Evolution of linear mitochondrial DNA in three known lineages of Polytomella. Curr. Genet., 56:427-438.
Primary citation for organism's characterization, if available	Pringsheim, E. G. 1955. The genus Polytomella. J. Protozool., 2:137?145.
Collection date	05-JUN-49
Sample collection site	OTHER
Other collection site info	Cambridge, artificial garden basin in Shelford
Sample material (e.g. "seawater," "sediment," etc.)	Soil
ENVO term for habitat - primary term	Aquatic: freshwater
ENVO term for habitat - secondary term	Soil
Habitat	freshwater habitat
Country	UNITED KINGDOM
Experimental Data
Date of experiment	15-MAY-11
Growth medium	0.1% tryptone, 0.2% yeast extract, 0.2% sodium acetate
Temperature (ºC)	22
pH	7
Investigation type	Eukaryotes