Lankesteria abbottii Grappler Inlet BC

Downloads:

Reads

Annotations

Peptides

Contigs

CDS

Environmental Data
Principle Investigator(s)	Claudio Slamovits
External sample ID	L.abbottii Grappler Inlet
NCGR Sample ID	MMETSP0372
Sample accession number	CAM_SMPL_002541
Assembly accession number	CAM_ASM_000359
Combined Assembly Name	N/A
Genus	Lankesteria
Species	abbottii
Strain	Grappler Inlet BC
Clonal	No
Axenic	No
Prelim. NCBI Taxon ID	340204
18S rRNA	ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCGCAGATTAAGCCATGCATGTCTAAGTGTAAATACTTTACAGTAAAACTGCGGATGGCCCATTACAACAGTTATTGTTTGCTTGGAGCATACCTCTACGGATATCCGTGGAAATTCTACAGTTAATACGTACCATACTAATTTTATTAGTATGTTGCATATTACTGTGAACGTTCAACAGGCTTGCCTGTTAACTATGAACAATTTTATGCATGAATCGCTTCGGCGAAAGTCCATCAAAGTTTCTGACCCATCAGGTTCCGACGGTAAGGTATTGGCTTACCGTGCCGATAACGGGTAACGGGGGATTAGGGTTCGATCCCGGAGAGGGAGCTTGAGAGATAGCTACCACATCTAAGGAAGGCAGCAGGCGCGCAAATTACCTATCCCTGACTCAGGGAGGTAGTAAACAGCAATACTGACGCATGATTTTAATCGTGCGATCGGGAATGGATGGTTTCTAAACAAAACCATGAAAACCATTAGAGGAAAAGTCTGGTGCCAGCACCCGCGGTAATACCAGCTCTAATAGCGTATATTATTAATGTTGCAGTTGAAACGTTCGTAGTCGATCCTTATCTGCTACAGTTTTATGTTATTTTCAATAGCATATCTCTTCAGCGGAAATTGCATGGATCCTTACATGTTTCATGTAAGGTTTTTCATGTTTTACTTTGAGTGAATCGGCGTGTTCCACGCAGGCAATCTGCCTTGAACGATTTACCATAGTATAAGGACAGTATGGAAATATCTCCTTGTTCGTTTGAAGATACTTTCGATACGTAAAAGAACGGTTGAGGGCATTCGTATTCAACTGCTAGAGGTGAAATTCTTTGATTAGTTGAGGACGAACCATTGCGAAAGCATCTGCCCAGGACGTTTCTTTTGATCAAGAACGAAAGTTAGGTGATCGAAGATGATTAGATACCGTTGTAGTCCTAACTATAAACTTTACTATCCAAGAATTGGATTGGTGACTTTACGCCTCTCCAGTACTTTCTGAGAAATCATAAGTCTTTGAGTTCTGGGGGGAGTATAGTTGTAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGAACTTGCGGCTTAATTTGACTCAACACGGAAAACCTTACGAGGATAAGACAAACGAAGGATTGACAGATTGATCGCTCTTTCTTGATTGTTTGGGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGATTAATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTTAACTTGCTAATTAGAATTGTAGATTTATCTACTATTCTGTTAGAAGGACCGTGTGTTCCTAACACAAGGAAGCGTGAGGCAATAACAGGTCTGTGATGCCCTTAGATATCCTCGGCAGCACGCGTGTTACAATGATGTGTATAAAATGTTTACTATTCGAAAGAATTGTGCAATCATTAATACACATCAACCCAGGAATTGTTTGTTGGAACGTCAAACATCAACTAGGAATTCCTAGTAAACGCGTATCATTAGTTCGCGTTGATTACGTCCCTGCCCTTTGTACACACCGCCTGTCGCATCTATTGATTAGGTTGTATCATGAGTTAGGCGGA
Importance of organism and transcriptomes	Lankesteria abbotti is a marine gregarine apicomplexan found in the intestines of a tunicate Clavelina huntsmani that inhabits rocky intertidal zones in coastal British Columbia and California (Leander et al. 2006, Levine 1981). L. abbotti, like most gregarines, completes its life cycle within the intestines of a single host, where two individuals pair up in process called syzygy (the onset of sexual reproduction and cyst formation). The sequenced transcriptome of L. abbotti will enable comparisons of gene content, endosymbiotic gene transfer and the genetic basis of various curious metabolic properties of diverse apicomplexans; L. abbotti will also serve as an outgroup for these comparisons with other apicomplexans. L. abbotti is of great interest because it is a relatively accessible representative of marine eugregarines, which is an extremely diverse lineage of apicomplexans at both morphological and molecular levels (Leander and Keeling 2003, Leander et al. 2006, Leander 2008). Gregarines are unusually large in cell size compared to other better-known apicomplexans with small sequenced genomes such as Plasmodium, Toxoplasma, Eimeria and Cryptosporidium (Leander 2008). There is some genetic data from expressed sequence tags of Gregarina niphandrodes (Omoto et al. 2004) and genome survey sequences of Ascogregarina taiwanensis (Templeton et al. 2010), which are terrestrial gregarines that are distantly related to L. abbotti in ribosomal RNA phylogenies. We hope to exploit new sequencing technology to get a more complete estimate of gene content from the L. abbotti transcriptome than was possible from earlier partial transcriptome and partial genome studies of gregarines, and use this information to infer the early evolutionary history of apicomplexan parasites.
Additional citations and references	Leander, B. S. 2008. Marine gregarines: evolutionary prelude to the apicomplexan radiation? Trends in Parasitology, 24:60-67.; Leander, B. S. & Keeling, P. J. 2003. Morphostasis in alveolate evolution. Trends in Ecology & Evolution, 18:395-402.;Leander, B. S., Lloyd, S. A. J., Marshall, W. & Landers, S. C. 2006. Phylogeny of marine gregarines (Apicomplexa) - Pterospora, Lithopystis and Lankesteria - and the origin(s) of coelomic parasitism. Protist, 157:45-60.;Levine, N. D. 1981. New species of Lankesteria (Apicomplexa, Eugregarinida) from ascidians on the central California coast. Journal of Eukaryotic Microbiology, 28:363-370.;Omoto, C. K., Toso, M., Tang, K. & Sibley, L. D. 2004. Expressed sequence tag (EST) analysis of Gregarine gametocyst development. Int J Parasitol, 34:1265-71.;Templeton, T. J., Enomoto, S., Chen, W. J., Huang, C. G., Lancto, C. A., Abrahamsen, M. S. & Zhu, G. 2010. A genome-sequence survey for Ascogregarina taiwanensis supports evolutionary affiliation but metabolic diversity between a Gregarine and Cryptosporidium. Mol Biol Evol, 27:235-48.
Primary citation for organism's characterization, if available	PMID:16352468
Latitude	48.83375
Longitude	125.13023
Depth (m)	.2
Temperature (ºC)	13
Collection date	13-JUN-10
Collection time	07:30 AM
Sample collection site	Pacific_Ocean
Other collection site info	Grappler Inlet BC, off Barkley Sound of Pacific Ocean.
Sample material (e.g. "seawater," "sediment," etc.)	Cells were handpicked by micropipette from the intestines of its host ascidian, Clavelina huntsmani,collected from the rocky shore near the mouth of Grappler Inlet. Cells were washed in sterile seawater three times.
ENVO term for habitat - primary term	Organism-Associated
ENVO term for habitat - secondary term	Other
Habitat description	intestine of marine tunicate Clavelina huntsmani found in NW Pacific rocky intertidal zone
Habitat	organism-associated habitat
Country	CANADA
Experimental Data
Date of experiment	13-JUN-10
Growth medium	uncultivable
Modifications to growth medium	uncultivable
Investigation type	Eukaryotes